ID: 1122076023_1122076039

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122076023 1122076039
Species Human (GRCh38) Human (GRCh38)
Location 14:99235115-99235137 14:99235168-99235190
Sequence CCCATCCGGGTTTCAGGGGGAAT GGCGTCCCCTCCCAAATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52} {0: 1, 1: 0, 2: 2, 3: 13, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!