ID: 1122076705_1122076712

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1122076705 1122076712
Species Human (GRCh38) Human (GRCh38)
Location 14:99239791-99239813 14:99239843-99239865
Sequence CCATGAACTCCAATGCTGGCTTT TGGAATAAACAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 202} {0: 1, 1: 0, 2: 4, 3: 73, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!