ID: 1122079370_1122079374

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122079370 1122079374
Species Human (GRCh38) Human (GRCh38)
Location 14:99256499-99256521 14:99256514-99256536
Sequence CCAGCACAGGCTGCTGCTTTTTA GCTTTTTAGGGAACCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 262} {0: 1, 1: 0, 2: 0, 3: 21, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!