ID: 1122100901_1122100910

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122100901 1122100910
Species Human (GRCh38) Human (GRCh38)
Location 14:99408926-99408948 14:99408962-99408984
Sequence CCTTCCAAGGCTGTAAGGACCCC GGCCTTCTGGCAGGAGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 140} {0: 1, 1: 1, 2: 4, 3: 39, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!