ID: 1122120492_1122120499

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1122120492 1122120499
Species Human (GRCh38) Human (GRCh38)
Location 14:99550870-99550892 14:99550908-99550930
Sequence CCAGGCCACACTCCTCCAATATA GTCCAGCTCGACCAAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127} {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!