ID: 1122131555_1122131560

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122131555 1122131560
Species Human (GRCh38) Human (GRCh38)
Location 14:99606803-99606825 14:99606816-99606838
Sequence CCCACACCAGGGCTGGGAATGCT TGGGAATGCTTGGGCAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181} {0: 1, 1: 0, 2: 0, 3: 23, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!