ID: 1122150242_1122150246

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1122150242 1122150246
Species Human (GRCh38) Human (GRCh38)
Location 14:99721754-99721776 14:99721776-99721798
Sequence CCCTTCTCCTTCTGGACCTCAGT TTTCTCCATCTGTCACGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 86, 4: 536} {0: 1, 1: 1, 2: 8, 3: 71, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!