ID: 1122150997_1122151001

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1122150997 1122151001
Species Human (GRCh38) Human (GRCh38)
Location 14:99726226-99726248 14:99726242-99726264
Sequence CCGCTCCTGCATCGGGCAGCAGT CAGCAGTTTGCTCAGGTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 139} {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!