ID: 1122157237_1122157240

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1122157237 1122157240
Species Human (GRCh38) Human (GRCh38)
Location 14:99756952-99756974 14:99756972-99756994
Sequence CCCACAATGACACGCAGTTCTAC TACACACACATCCCCAGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61} {0: 1, 1: 0, 2: 1, 3: 29, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!