ID: 1122221000_1122221010

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122221000 1122221010
Species Human (GRCh38) Human (GRCh38)
Location 14:100239122-100239144 14:100239146-100239168
Sequence CCCCCGCCCGCTCGCCGCCTTCC CCCTCTGCCTTCCTTCCCCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 48, 4: 500} {0: 1, 1: 0, 2: 9, 3: 97, 4: 877}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!