ID: 1122230744_1122230756

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122230744 1122230756
Species Human (GRCh38) Human (GRCh38)
Location 14:100305488-100305510 14:100305529-100305551
Sequence CCCGACGCCCACGGTCGGGGCAT CGCCCGCCCGGGCCCTCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 0, 2: 2, 3: 21, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!