ID: 1122244411_1122244414

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122244411 1122244414
Species Human (GRCh38) Human (GRCh38)
Location 14:100391857-100391879 14:100391870-100391892
Sequence CCTTTTCCATTCTCCTTCTCTCC CCTTCTCTCCTGAGTGTACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 275, 4: 2124} {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!