ID: 1122245960_1122245964

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1122245960 1122245964
Species Human (GRCh38) Human (GRCh38)
Location 14:100403824-100403846 14:100403858-100403880
Sequence CCCTCAGACTTCCATCGAGATGA AATATTCCAGTTTGCTTGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79} {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!