ID: 1122246946_1122246955

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122246946 1122246955
Species Human (GRCh38) Human (GRCh38)
Location 14:100410088-100410110 14:100410129-100410151
Sequence CCAAACCCCATCTGAGTTTCCAG CTATTGTTAAAGTGATTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 249} {0: 1, 1: 0, 2: 0, 3: 12, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!