ID: 1122249042_1122249049

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1122249042 1122249049
Species Human (GRCh38) Human (GRCh38)
Location 14:100425235-100425257 14:100425261-100425283
Sequence CCCTTCTCCATCCTACCTCCCTT GTGCACATCCTGTCACCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 306, 4: 2141} {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!