|
Left Crispr |
Right Crispr |
| Crispr ID |
1122260631 |
1122260636 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:100518718-100518740
|
14:100518766-100518788
|
| Sequence |
CCGTCTCTACTAAAATACAAAAA |
CTGTAGTCCCAGCTAGAGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5223, 1: 6023, 2: 7527, 3: 27046, 4: 265462} |
{0: 1, 1: 4, 2: 98, 3: 965, 4: 4774} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|