ID: 1122264844_1122264855

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122264844 1122264855
Species Human (GRCh38) Human (GRCh38)
Location 14:100541735-100541757 14:100541771-100541793
Sequence CCATAGCCCCTGGGGCACCTGGC CCCTGGGCTGTCCATGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 333} {0: 1, 1: 0, 2: 0, 3: 20, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!