ID: 1122265916_1122265917

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1122265916 1122265917
Species Human (GRCh38) Human (GRCh38)
Location 14:100546761-100546783 14:100546813-100546835
Sequence CCGGCGCGCGCGCGCGCGCGCAC CTCACACACACCCAGCCTCCCGG
Strand - +
Off-target summary {0: 4, 1: 15, 2: 38, 3: 155, 4: 528} {0: 1, 1: 0, 2: 6, 3: 106, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!