ID: 1122273904_1122273916

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1122273904 1122273916
Species Human (GRCh38) Human (GRCh38)
Location 14:100581417-100581439 14:100581451-100581473
Sequence CCTGCTCACCTACCAGCAGCCTG CTGGAGGGGCTTCCGGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 347} {0: 1, 1: 0, 2: 2, 3: 32, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!