ID: 1122289419_1122289427

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1122289419 1122289427
Species Human (GRCh38) Human (GRCh38)
Location 14:100672186-100672208 14:100672233-100672255
Sequence CCTCCTGCCCTCTTGTGCCACAG CCCCAGAGGTCCTGTGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 328} {0: 1, 1: 0, 2: 2, 3: 32, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!