ID: 1122297206_1122297215

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1122297206 1122297215
Species Human (GRCh38) Human (GRCh38)
Location 14:100712292-100712314 14:100712321-100712343
Sequence CCCCTGCCTCAGGGCCACAGAGG GCCGGTAGGCAACAGCATCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!