ID: 1122309669_1122309679

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1122309669 1122309679
Species Human (GRCh38) Human (GRCh38)
Location 14:100786427-100786449 14:100786464-100786486
Sequence CCTGCATGCCAGGGATGTGGGAT CATCCAGTGGCAGTGCCCCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!