ID: 1122310599_1122310607

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1122310599 1122310607
Species Human (GRCh38) Human (GRCh38)
Location 14:100791900-100791922 14:100791925-100791947
Sequence CCTCTCTGAGTGGGCACACGGCA GGGCCAGAAGTCAGGGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 63, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!