ID: 1122310599_1122310611

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1122310599 1122310611
Species Human (GRCh38) Human (GRCh38)
Location 14:100791900-100791922 14:100791944-100791966
Sequence CCTCTCTGAGTGGGCACACGGCA GGGGGCCAGGATGCCTCTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 20, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!