ID: 1122311924_1122311929

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1122311924 1122311929
Species Human (GRCh38) Human (GRCh38)
Location 14:100802920-100802942 14:100802938-100802960
Sequence CCCTGCCCTGCTGGAGGGAGAAC AGAACACAGCTGGCTAAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!