ID: 1122316776_1122316784

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1122316776 1122316784
Species Human (GRCh38) Human (GRCh38)
Location 14:100830111-100830133 14:100830157-100830179
Sequence CCTTCTTCCCCTCTGGCCCAGAG CAAACCAAATGTTTGACAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 505} {0: 1, 1: 0, 2: 3, 3: 57, 4: 526}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!