ID: 1122376236_1122376251

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1122376236 1122376251
Species Human (GRCh38) Human (GRCh38)
Location 14:101261032-101261054 14:101261074-101261096
Sequence CCATGGTTTCAGGCACCCACTGG CTGTGGATAAAGGGGGATGATGG
Strand - +
Off-target summary {0: 6, 1: 97, 2: 213, 3: 347, 4: 621} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!