ID: 1122425190_1122425206

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1122425190 1122425206
Species Human (GRCh38) Human (GRCh38)
Location 14:101601679-101601701 14:101601731-101601753
Sequence CCCTCACCTCTCTGAGCCTTCTG CCCCGCTGTTGGAAAGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 103, 4: 676} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!