|
Left Crispr |
Right Crispr |
| Crispr ID |
1122440776 |
1122440783 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:101730472-101730494
|
14:101730520-101730542
|
| Sequence |
CCAGGCCCGTGGAACTGTGAGTC |
CCTTATAATTTACCCAGTCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 21, 2: 901, 3: 5473, 4: 8499} |
{0: 2, 1: 151, 2: 3861, 3: 4611, 4: 3372} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|