|
Left Crispr |
Right Crispr |
| Crispr ID |
1122440776 |
1122440784 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:101730472-101730494
|
14:101730521-101730543
|
| Sequence |
CCAGGCCCGTGGAACTGTGAGTC |
CTTATAATTTACCCAGTCTCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 21, 2: 901, 3: 5473, 4: 8499} |
{0: 7, 1: 517, 2: 7831, 3: 14330, 4: 14695} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|