ID: 1122445128_1122445141

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122445128 1122445141
Species Human (GRCh38) Human (GRCh38)
Location 14:101762115-101762137 14:101762151-101762173
Sequence CCGGGGATCGCGCCGGAGCCGCG GGCCGCTGGGACCTTCGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98} {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!