ID: 1122464815_1122464817

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1122464815 1122464817
Species Human (GRCh38) Human (GRCh38)
Location 14:101924735-101924757 14:101924751-101924773
Sequence CCAGCCAGAAATTTCTGCTTCTT GCTTCTTGAAATGCTTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 482} {0: 1, 1: 0, 2: 1, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!