|
Left Crispr |
Right Crispr |
| Crispr ID |
1122471807 |
1122471818 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:101973278-101973300
|
14:101973330-101973352
|
| Sequence |
CCTCCCAAATAACTGAAATTACA |
TTTAATTTTTAGTAGGTATAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 37, 2: 1110, 3: 17380, 4: 138822} |
{0: 1, 1: 1, 2: 71, 3: 1422, 4: 19389} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|