ID: 1122471809_1122471818

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1122471809 1122471818
Species Human (GRCh38) Human (GRCh38)
Location 14:101973281-101973303 14:101973330-101973352
Sequence CCCAAATAACTGAAATTACAGGT TTTAATTTTTAGTAGGTATAGGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 420, 3: 7099, 4: 60826} {0: 1, 1: 1, 2: 71, 3: 1422, 4: 19389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!