ID: 1122474652_1122474663

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1122474652 1122474663
Species Human (GRCh38) Human (GRCh38)
Location 14:101998644-101998666 14:101998696-101998718
Sequence CCATCCTGCCTGTAACCGTTTCC TGTGCTTAATTTTGATTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 135} {0: 1, 1: 0, 2: 3, 3: 20, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!