ID: 1122480228_1122480242

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1122480228 1122480242
Species Human (GRCh38) Human (GRCh38)
Location 14:102042460-102042482 14:102042505-102042527
Sequence CCGCATGCCTGCTTCCGACTCTT AAGGTGGGTGGTTGAAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172} {0: 1, 1: 0, 2: 3, 3: 36, 4: 544}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!