ID: 1122501378_1122501387

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1122501378 1122501387
Species Human (GRCh38) Human (GRCh38)
Location 14:102202260-102202282 14:102202303-102202325
Sequence CCTCCTGTGGCAGCTCCTTCCTC GCACTTCTGGGTTGTTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 491} {0: 1, 1: 0, 2: 2, 3: 21, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!