ID: 1122505572_1122505582

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1122505572 1122505582
Species Human (GRCh38) Human (GRCh38)
Location 14:102229795-102229817 14:102229823-102229845
Sequence CCAGGTCCCAGACACCCCAAGGG CTGCCCACTAGAGTCCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 243} {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!