ID: 1122505575_1122505583

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1122505575 1122505583
Species Human (GRCh38) Human (GRCh38)
Location 14:102229801-102229823 14:102229824-102229846
Sequence CCCAGACACCCCAAGGGAGTGGC TGCCCACTAGAGTCCCACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137} {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!