ID: 1122506314_1122506320

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1122506314 1122506320
Species Human (GRCh38) Human (GRCh38)
Location 14:102234051-102234073 14:102234085-102234107
Sequence CCCTCAATCTGTAAGCTTGGGGC ACTGTTAAGCGGCCGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 7, 3: 12, 4: 98} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!