ID: 1122519533_1122519535

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122519533 1122519535
Species Human (GRCh38) Human (GRCh38)
Location 14:102333786-102333808 14:102333801-102333823
Sequence CCTCTGCCTTTCATGTCTGAGCA TCTGAGCAGAGCCCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 398} {0: 1, 1: 0, 2: 0, 3: 21, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!