ID: 1122554102_1122554113

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122554102 1122554113
Species Human (GRCh38) Human (GRCh38)
Location 14:102567577-102567599 14:102567630-102567652
Sequence CCTCAGGTGATCCTGCAGATCCG ACAGGCGTGAGCCACCCGACGGG
Strand - +
Off-target summary No data {0: 1, 1: 31, 2: 781, 3: 3824, 4: 7358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!