ID: 1122554104_1122554109

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122554104 1122554109
Species Human (GRCh38) Human (GRCh38)
Location 14:102567597-102567619 14:102567612-102567634
Sequence CCGCCCACCTCAGCCTCCCACAG TCCCACAGTGCTGAGATTACAGG
Strand - +
Off-target summary No data {0: 192, 1: 20102, 2: 317242, 3: 255706, 4: 140693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!