ID: 1122554106_1122554114

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1122554106 1122554114
Species Human (GRCh38) Human (GRCh38)
Location 14:102567601-102567623 14:102567638-102567660
Sequence CCACCTCAGCCTCCCACAGTGCT GAGCCACCCGACGGGCTCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!