|
Left Crispr |
Right Crispr |
| Crispr ID |
1122563762 |
1122563769 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:102636401-102636423
|
14:102636450-102636472
|
| Sequence |
CCAAGTAGCTGGGATTACAGGTG |
TGTATTTGTTTACTAGAGATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720} |
{0: 1, 1: 12, 2: 1016, 3: 4036, 4: 15349} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|