|
Left Crispr |
Right Crispr |
| Crispr ID |
1122563764 |
1122563769 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:102636428-102636450
|
14:102636450-102636472
|
| Sequence |
CCACCACACCCCGCTAACTTTTT |
TGTATTTGTTTACTAGAGATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 684, 2: 20270, 3: 101571, 4: 192631} |
{0: 1, 1: 12, 2: 1016, 3: 4036, 4: 15349} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|