ID: 1122563766_1122563769

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1122563766 1122563769
Species Human (GRCh38) Human (GRCh38)
Location 14:102636436-102636458 14:102636450-102636472
Sequence CCCCGCTAACTTTTTGTATTTGT TGTATTTGTTTACTAGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 2725, 3: 77698, 4: 48792} {0: 1, 1: 12, 2: 1016, 3: 4036, 4: 15349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!