ID: 1122589541_1122589546

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122589541 1122589546
Species Human (GRCh38) Human (GRCh38)
Location 14:102837380-102837402 14:102837393-102837415
Sequence CCTTCCACCTTGACCTTCCAAAG CCTTCCAAAGTCAAAGTGCTGGG
Strand - +
Off-target summary {0: 2, 1: 166, 2: 3351, 3: 31924, 4: 89152} {0: 2, 1: 4, 2: 5, 3: 43, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!