|
Left Crispr |
Right Crispr |
| Crispr ID |
1122589541 |
1122589549 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:102837380-102837402
|
14:102837420-102837442
|
| Sequence |
CCTTCCACCTTGACCTTCCAAAG |
CAGGTGTGAGCCACCGTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 166, 2: 3351, 3: 31924, 4: 89152} |
{0: 5442, 1: 34090, 2: 96783, 3: 140914, 4: 159590} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|