ID: 1122594176_1122594182

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1122594176 1122594182
Species Human (GRCh38) Human (GRCh38)
Location 14:102877824-102877846 14:102877847-102877869
Sequence CCTTCCGCAGGCCCTCCCTCAAC TCATAGATAATCCGTTCCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 291} {0: 12, 1: 16, 2: 3, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!